ID: 981782855

View in Genome Browser
Species Human (GRCh38)
Location 4:148445472-148445494
Sequence GGCGGCTCAGACGCCCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981782851_981782855 -9 Left 981782851 4:148445458-148445480 CCCCTCGCTCTGACGGCGGCTCA No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data
981782852_981782855 -10 Left 981782852 4:148445459-148445481 CCCTCGCTCTGACGGCGGCTCAG No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data
981782849_981782855 -4 Left 981782849 4:148445453-148445475 CCGGTCCCCTCGCTCTGACGGCG No data
Right 981782855 4:148445472-148445494 GGCGGCTCAGACGCCCGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981782855 Original CRISPR GGCGGCTCAGACGCCCGCGG AGG Intergenic