ID: 981790370

View in Genome Browser
Species Human (GRCh38)
Location 4:148529585-148529607
Sequence TTGTCCCACTGTAAGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981790370_981790374 26 Left 981790370 4:148529585-148529607 CCATAGACCTTACAGTGGGACAA No data
Right 981790374 4:148529634-148529656 TCATGATCCTGACCCTGTACAGG No data
981790370_981790373 -10 Left 981790370 4:148529585-148529607 CCATAGACCTTACAGTGGGACAA No data
Right 981790373 4:148529598-148529620 AGTGGGACAAGTTGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981790370 Original CRISPR TTGTCCCACTGTAAGGTCTA TGG (reversed) Intergenic
No off target data available for this crispr