ID: 981794173

View in Genome Browser
Species Human (GRCh38)
Location 4:148576828-148576850
Sequence ACTCAGGAGGCTGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794173_981794184 28 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794173_981794181 2 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794173_981794182 6 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794173_981794183 27 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794173_981794179 -8 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794179 4:148576843-148576865 TCCTGAGTAGCTGGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794173 Original CRISPR ACTCAGGAGGCTGAGGCAGG AGG (reversed) Intergenic