ID: 981794174

View in Genome Browser
Species Human (GRCh38)
Location 4:148576831-148576853
Sequence GCTACTCAGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794174_981794183 24 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794174_981794181 -1 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794174_981794184 25 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794174_981794182 3 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794174 Original CRISPR GCTACTCAGGAGGCTGAGGC AGG (reversed) Intergenic