ID: 981794176

View in Genome Browser
Species Human (GRCh38)
Location 4:148576835-148576857
Sequence CCCAGCTACTCAGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794176_981794184 21 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794176_981794183 20 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794176_981794182 -1 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794176_981794181 -5 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794176 Original CRISPR CCCAGCTACTCAGGAGGCTG AGG (reversed) Intergenic