ID: 981794178

View in Genome Browser
Species Human (GRCh38)
Location 4:148576841-148576863
Sequence TGTAGTCCCAGCTACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794178_981794182 -7 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794178_981794184 15 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794178_981794183 14 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794178 Original CRISPR TGTAGTCCCAGCTACTCAGG AGG (reversed) Intergenic