ID: 981794180

View in Genome Browser
Species Human (GRCh38)
Location 4:148576844-148576866
Sequence GCCTGTAGTCCCAGCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794180_981794184 12 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794180_981794183 11 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794180_981794182 -10 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794180 Original CRISPR GCCTGTAGTCCCAGCTACTC AGG (reversed) Intergenic