ID: 981794181

View in Genome Browser
Species Human (GRCh38)
Location 4:148576853-148576875
Sequence CTGGGACTACAGGCATTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794173_981794181 2 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794176_981794181 -5 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794171_981794181 27 Left 981794171 4:148576803-148576825 CCTTTAACTCCTGGGCTCAAGTG No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794172_981794181 18 Left 981794172 4:148576812-148576834 CCTGGGCTCAAGTGATCCTCCTG No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data
981794174_981794181 -1 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794181 4:148576853-148576875 CTGGGACTACAGGCATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794181 Original CRISPR CTGGGACTACAGGCATTATC TGG Intergenic