ID: 981794182

View in Genome Browser
Species Human (GRCh38)
Location 4:148576857-148576879
Sequence GACTACAGGCATTATCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794176_981794182 -1 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794180_981794182 -10 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794178_981794182 -7 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794173_981794182 6 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794172_981794182 22 Left 981794172 4:148576812-148576834 CCTGGGCTCAAGTGATCCTCCTG No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data
981794174_981794182 3 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794182 4:148576857-148576879 GACTACAGGCATTATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794182 Original CRISPR GACTACAGGCATTATCTGGA AGG Intergenic