ID: 981794183

View in Genome Browser
Species Human (GRCh38)
Location 4:148576878-148576900
Sequence GGATTCTCAAAAAAGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794174_981794183 24 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794180_981794183 11 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794173_981794183 27 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794178_981794183 14 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794176_981794183 20 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794183 Original CRISPR GGATTCTCAAAAAAGCTTGT TGG Intergenic