ID: 981794183

View in Genome Browser
Species Human (GRCh38)
Location 4:148576878-148576900
Sequence GGATTCTCAAAAAAGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794176_981794183 20 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794180_981794183 11 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794173_981794183 27 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT 0: 4945
1: 11993
2: 28383
3: 42039
4: 82442
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794178_981794183 14 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data
981794174_981794183 24 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 981794183 4:148576878-148576900 GGATTCTCAAAAAAGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794183 Original CRISPR GGATTCTCAAAAAAGCTTGT TGG Intergenic
No off target data available for this crispr