ID: 981794184

View in Genome Browser
Species Human (GRCh38)
Location 4:148576879-148576901
Sequence GATTCTCAAAAAAGCTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981794174_981794184 25 Left 981794174 4:148576831-148576853 CCTGCCTCAGCCTCCTGAGTAGC No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794180_981794184 12 Left 981794180 4:148576844-148576866 CCTGAGTAGCTGGGACTACAGGC No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794178_981794184 15 Left 981794178 4:148576841-148576863 CCTCCTGAGTAGCTGGGACTACA No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794173_981794184 28 Left 981794173 4:148576828-148576850 CCTCCTGCCTCAGCCTCCTGAGT No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data
981794176_981794184 21 Left 981794176 4:148576835-148576857 CCTCAGCCTCCTGAGTAGCTGGG No data
Right 981794184 4:148576879-148576901 GATTCTCAAAAAAGCTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981794184 Original CRISPR GATTCTCAAAAAAGCTTGTT GGG Intergenic