ID: 981795031 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:148585892-148585914 |
| Sequence | GAGGGTAAGCTGAAGCAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2768 | |||
| Summary | {0: 8, 1: 246, 2: 609, 3: 899, 4: 1006} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981795031_981795042 | 24 | Left | 981795031 | 4:148585892-148585914 | CCACCCTGCTTCAGCTTACCCTC | 0: 8 1: 246 2: 609 3: 899 4: 1006 |
||
| Right | 981795042 | 4:148585939-148585961 | CAGTCCCGATGAGATGAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981795031 | Original CRISPR | GAGGGTAAGCTGAAGCAGGG TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||