ID: 981795031

View in Genome Browser
Species Human (GRCh38)
Location 4:148585892-148585914
Sequence GAGGGTAAGCTGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2768
Summary {0: 8, 1: 246, 2: 609, 3: 899, 4: 1006}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981795031_981795042 24 Left 981795031 4:148585892-148585914 CCACCCTGCTTCAGCTTACCCTC 0: 8
1: 246
2: 609
3: 899
4: 1006
Right 981795042 4:148585939-148585961 CAGTCCCGATGAGATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981795031 Original CRISPR GAGGGTAAGCTGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr