ID: 981797528

View in Genome Browser
Species Human (GRCh38)
Location 4:148613945-148613967
Sequence ATCTAGAAGCTGGATGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981797526_981797528 4 Left 981797526 4:148613918-148613940 CCATTCAAACAATATTGACAAAT No data
Right 981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG No data
981797525_981797528 5 Left 981797525 4:148613917-148613939 CCCATTCAAACAATATTGACAAA No data
Right 981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981797528 Original CRISPR ATCTAGAAGCTGGATGAATA TGG Intergenic
No off target data available for this crispr