ID: 981799318

View in Genome Browser
Species Human (GRCh38)
Location 4:148637300-148637322
Sequence ACTAGGCAGTGCCCCAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981799313_981799318 -5 Left 981799313 4:148637282-148637304 CCCTTTTCTCACAGCTCCACTAG 0: 114
1: 1835
2: 2055
3: 1345
4: 961
Right 981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG No data
981799314_981799318 -6 Left 981799314 4:148637283-148637305 CCTTTTCTCACAGCTCCACTAGG 0: 128
1: 1759
2: 2056
3: 1417
4: 948
Right 981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981799318 Original CRISPR ACTAGGCAGTGCCCCAGTTA GGG Intergenic
No off target data available for this crispr