ID: 981801539

View in Genome Browser
Species Human (GRCh38)
Location 4:148663343-148663365
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981801536_981801539 18 Left 981801536 4:148663302-148663324 CCATTTTGGGTCAACTATATCTT No data
Right 981801539 4:148663343-148663365 CTGAACTATCAATTAATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type