ID: 981807963

View in Genome Browser
Species Human (GRCh38)
Location 4:148738822-148738844
Sequence TGGCACGGCCCGGGGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981807950_981807963 24 Left 981807950 4:148738775-148738797 CCTTCCAAATTGACAATCCTAAT No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data
981807951_981807963 20 Left 981807951 4:148738779-148738801 CCAAATTGACAATCCTAATTGTT No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data
981807948_981807963 29 Left 981807948 4:148738770-148738792 CCCTTCCTTCCAAATTGACAATC No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data
981807956_981807963 -3 Left 981807956 4:148738802-148738824 CCTTTCTCACTGGGTCACGGTGG No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data
981807949_981807963 28 Left 981807949 4:148738771-148738793 CCTTCCTTCCAAATTGACAATCC No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data
981807952_981807963 7 Left 981807952 4:148738792-148738814 CCTAATTGTTCCTTTCTCACTGG No data
Right 981807963 4:148738822-148738844 TGGCACGGCCCGGGGATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981807963 Original CRISPR TGGCACGGCCCGGGGATGAT GGG Intergenic
No off target data available for this crispr