ID: 981808627

View in Genome Browser
Species Human (GRCh38)
Location 4:148747119-148747141
Sequence CTTCTGTGAGCACTATCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981808624_981808627 25 Left 981808624 4:148747071-148747093 CCATGTAAAATTAAATTTATATC No data
Right 981808627 4:148747119-148747141 CTTCTGTGAGCACTATCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981808627 Original CRISPR CTTCTGTGAGCACTATCCAA GGG Intergenic
No off target data available for this crispr