ID: 981812114

View in Genome Browser
Species Human (GRCh38)
Location 4:148787918-148787940
Sequence GTGTTCAATGCAAATTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981812114_981812117 17 Left 981812114 4:148787918-148787940 CCAGCAGAATTTGCATTGAACAC No data
Right 981812117 4:148787958-148787980 CCGACACTGGCTTTTCCATCAGG No data
981812114_981812118 27 Left 981812114 4:148787918-148787940 CCAGCAGAATTTGCATTGAACAC No data
Right 981812118 4:148787968-148787990 CTTTTCCATCAGGTTATTTCAGG No data
981812114_981812115 4 Left 981812114 4:148787918-148787940 CCAGCAGAATTTGCATTGAACAC No data
Right 981812115 4:148787945-148787967 TGTCATGTGTCATCCGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981812114 Original CRISPR GTGTTCAATGCAAATTCTGC TGG (reversed) Intergenic
No off target data available for this crispr