ID: 981813170

View in Genome Browser
Species Human (GRCh38)
Location 4:148798694-148798716
Sequence CTGATTCCACAGAGGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981813161_981813170 25 Left 981813161 4:148798646-148798668 CCAGGACTGCCGCACTGGAAACA No data
Right 981813170 4:148798694-148798716 CTGATTCCACAGAGGGCATTGGG No data
981813162_981813170 16 Left 981813162 4:148798655-148798677 CCGCACTGGAAACAATTCATACT No data
Right 981813170 4:148798694-148798716 CTGATTCCACAGAGGGCATTGGG No data
981813160_981813170 26 Left 981813160 4:148798645-148798667 CCCAGGACTGCCGCACTGGAAAC No data
Right 981813170 4:148798694-148798716 CTGATTCCACAGAGGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981813170 Original CRISPR CTGATTCCACAGAGGGCATT GGG Intergenic
No off target data available for this crispr