ID: 981817098

View in Genome Browser
Species Human (GRCh38)
Location 4:148843097-148843119
Sequence CAGGAAGAGGAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981817098_981817102 -7 Left 981817098 4:148843097-148843119 CCTGCTTCCTTCTCCTCTTCCTG No data
Right 981817102 4:148843113-148843135 CTTCCTGATATCCCCGGAAGTGG No data
981817098_981817108 18 Left 981817098 4:148843097-148843119 CCTGCTTCCTTCTCCTCTTCCTG No data
Right 981817108 4:148843138-148843160 ATATCTCGTAGACATAATCTTGG No data
981817098_981817103 -6 Left 981817098 4:148843097-148843119 CCTGCTTCCTTCTCCTCTTCCTG No data
Right 981817103 4:148843114-148843136 TTCCTGATATCCCCGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981817098 Original CRISPR CAGGAAGAGGAGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr