ID: 981818374

View in Genome Browser
Species Human (GRCh38)
Location 4:148857338-148857360
Sequence AGTCTGAGGGAGTCCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981818374_981818379 19 Left 981818374 4:148857338-148857360 CCCTCCACGGACTCCCTCAGACT No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981818374 Original CRISPR AGTCTGAGGGAGTCCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr