ID: 981818379

View in Genome Browser
Species Human (GRCh38)
Location 4:148857380-148857402
Sequence GTAATCCTGAGCAAGCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981818374_981818379 19 Left 981818374 4:148857338-148857360 CCCTCCACGGACTCCCTCAGACT No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data
981818377_981818379 6 Left 981818377 4:148857351-148857373 CCCTCAGACTTTGTTGTTTCAGT No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data
981818376_981818379 15 Left 981818376 4:148857342-148857364 CCACGGACTCCCTCAGACTTTGT No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data
981818378_981818379 5 Left 981818378 4:148857352-148857374 CCTCAGACTTTGTTGTTTCAGTG No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data
981818375_981818379 18 Left 981818375 4:148857339-148857361 CCTCCACGGACTCCCTCAGACTT No data
Right 981818379 4:148857380-148857402 GTAATCCTGAGCAAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981818379 Original CRISPR GTAATCCTGAGCAAGCTGTG AGG Intergenic
No off target data available for this crispr