ID: 981823617

View in Genome Browser
Species Human (GRCh38)
Location 4:148914520-148914542
Sequence GCAGCCAGGACTGCAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981823614_981823617 7 Left 981823614 4:148914490-148914512 CCACACAAGGATGGAGTTGTCGT No data
Right 981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG No data
981823613_981823617 8 Left 981823613 4:148914489-148914511 CCCACACAAGGATGGAGTTGTCG No data
Right 981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG No data
981823609_981823617 28 Left 981823609 4:148914469-148914491 CCATCTGTCTCCACAGCTCGCCC No data
Right 981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG No data
981823611_981823617 18 Left 981823611 4:148914479-148914501 CCACAGCTCGCCCACACAAGGAT No data
Right 981823617 4:148914520-148914542 GCAGCCAGGACTGCAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981823617 Original CRISPR GCAGCCAGGACTGCAGCAAC AGG Intergenic
No off target data available for this crispr