ID: 981823740

View in Genome Browser
Species Human (GRCh38)
Location 4:148915589-148915611
Sequence TGGAGATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981823740_981823748 23 Left 981823740 4:148915589-148915611 CCATCCACCACTGCTGATCTCCA No data
Right 981823748 4:148915635-148915657 TCCACTCCCCCAGATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981823740 Original CRISPR TGGAGATCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr