ID: 981824050

View in Genome Browser
Species Human (GRCh38)
Location 4:148918889-148918911
Sequence TGGAACCCCACCCTAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981824050_981824054 17 Left 981824050 4:148918889-148918911 CCTCGGCTTAGGGTGGGGTTCCA No data
Right 981824054 4:148918929-148918951 TAATTTGAAAATACCTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981824050 Original CRISPR TGGAACCCCACCCTAAGCCG AGG (reversed) Intergenic
No off target data available for this crispr