ID: 981824051

View in Genome Browser
Species Human (GRCh38)
Location 4:148918909-148918931
Sequence TTATGATAGGTTTATCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981824051_981824054 -3 Left 981824051 4:148918909-148918931 CCATCCTGATAAACCTATCATAA No data
Right 981824054 4:148918929-148918951 TAATTTGAAAATACCTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981824051 Original CRISPR TTATGATAGGTTTATCAGGA TGG (reversed) Intergenic
No off target data available for this crispr