ID: 981824054

View in Genome Browser
Species Human (GRCh38)
Location 4:148918929-148918951
Sequence TAATTTGAAAATACCTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981824051_981824054 -3 Left 981824051 4:148918909-148918931 CCATCCTGATAAACCTATCATAA No data
Right 981824054 4:148918929-148918951 TAATTTGAAAATACCTTAAGTGG No data
981824052_981824054 -7 Left 981824052 4:148918913-148918935 CCTGATAAACCTATCATAATTTG No data
Right 981824054 4:148918929-148918951 TAATTTGAAAATACCTTAAGTGG No data
981824050_981824054 17 Left 981824050 4:148918889-148918911 CCTCGGCTTAGGGTGGGGTTCCA No data
Right 981824054 4:148918929-148918951 TAATTTGAAAATACCTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981824054 Original CRISPR TAATTTGAAAATACCTTAAG TGG Intergenic
No off target data available for this crispr