ID: 981826514

View in Genome Browser
Species Human (GRCh38)
Location 4:148948211-148948233
Sequence TTGAAGATGAATTAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981826507_981826514 11 Left 981826507 4:148948177-148948199 CCAGTTTAACAACGATTGGTCAT No data
Right 981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981826514 Original CRISPR TTGAAGATGAATTAGGGGGA GGG Intergenic
No off target data available for this crispr