ID: 981836189

View in Genome Browser
Species Human (GRCh38)
Location 4:149057238-149057260
Sequence TATAACAGGAGTTTTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836189_981836194 20 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data
981836189_981836197 25 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836197 4:149057286-149057308 CTCTTTGGGAATAAGAGGAGGGG No data
981836189_981836198 26 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836198 4:149057287-149057309 TCTTTGGGAATAAGAGGAGGGGG No data
981836189_981836195 23 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836195 4:149057284-149057306 AACTCTTTGGGAATAAGAGGAGG No data
981836189_981836193 11 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data
981836189_981836196 24 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836196 4:149057285-149057307 ACTCTTTGGGAATAAGAGGAGGG No data
981836189_981836192 10 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836192 4:149057271-149057293 TTTATCTGTTCTGAACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836189 Original CRISPR TATAACAGGAGTTTTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr