ID: 981836190

View in Genome Browser
Species Human (GRCh38)
Location 4:149057241-149057263
Sequence TTGTATAACAGGAGTTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836190_981836192 7 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836192 4:149057271-149057293 TTTATCTGTTCTGAACTCTTTGG No data
981836190_981836195 20 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836195 4:149057284-149057306 AACTCTTTGGGAATAAGAGGAGG No data
981836190_981836197 22 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836197 4:149057286-149057308 CTCTTTGGGAATAAGAGGAGGGG No data
981836190_981836198 23 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836198 4:149057287-149057309 TCTTTGGGAATAAGAGGAGGGGG No data
981836190_981836194 17 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data
981836190_981836199 29 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836199 4:149057293-149057315 GGAATAAGAGGAGGGGGAACAGG No data
981836190_981836196 21 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836196 4:149057285-149057307 ACTCTTTGGGAATAAGAGGAGGG No data
981836190_981836193 8 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836190 Original CRISPR TTGTATAACAGGAGTTTTAG AGG (reversed) Intergenic
No off target data available for this crispr