ID: 981836191

View in Genome Browser
Species Human (GRCh38)
Location 4:149057252-149057274
Sequence TAAACAGTGACTTGTATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836191_981836195 9 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836195 4:149057284-149057306 AACTCTTTGGGAATAAGAGGAGG No data
981836191_981836198 12 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836198 4:149057287-149057309 TCTTTGGGAATAAGAGGAGGGGG No data
981836191_981836192 -4 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836192 4:149057271-149057293 TTTATCTGTTCTGAACTCTTTGG No data
981836191_981836196 10 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836196 4:149057285-149057307 ACTCTTTGGGAATAAGAGGAGGG No data
981836191_981836199 18 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836199 4:149057293-149057315 GGAATAAGAGGAGGGGGAACAGG No data
981836191_981836193 -3 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data
981836191_981836197 11 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836197 4:149057286-149057308 CTCTTTGGGAATAAGAGGAGGGG No data
981836191_981836194 6 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836191 Original CRISPR TAAACAGTGACTTGTATAAC AGG (reversed) Intergenic
No off target data available for this crispr