ID: 981836193

View in Genome Browser
Species Human (GRCh38)
Location 4:149057272-149057294
Sequence TTATCTGTTCTGAACTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836190_981836193 8 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data
981836189_981836193 11 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data
981836191_981836193 -3 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836193 4:149057272-149057294 TTATCTGTTCTGAACTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836193 Original CRISPR TTATCTGTTCTGAACTCTTT GGG Intergenic
No off target data available for this crispr