ID: 981836194

View in Genome Browser
Species Human (GRCh38)
Location 4:149057281-149057303
Sequence CTGAACTCTTTGGGAATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836189_981836194 20 Left 981836189 4:149057238-149057260 CCACCTCTAAAACTCCTGTTATA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data
981836191_981836194 6 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data
981836190_981836194 17 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836194 Original CRISPR CTGAACTCTTTGGGAATAAG AGG Intergenic
No off target data available for this crispr