ID: 981836199

View in Genome Browser
Species Human (GRCh38)
Location 4:149057293-149057315
Sequence GGAATAAGAGGAGGGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981836191_981836199 18 Left 981836191 4:149057252-149057274 CCTGTTATACAAGTCACTGTTTA No data
Right 981836199 4:149057293-149057315 GGAATAAGAGGAGGGGGAACAGG No data
981836190_981836199 29 Left 981836190 4:149057241-149057263 CCTCTAAAACTCCTGTTATACAA No data
Right 981836199 4:149057293-149057315 GGAATAAGAGGAGGGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981836199 Original CRISPR GGAATAAGAGGAGGGGGAAC AGG Intergenic
No off target data available for this crispr