ID: 981838007

View in Genome Browser
Species Human (GRCh38)
Location 4:149077914-149077936
Sequence CTGCTGTTTTTAAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981838007_981838012 12 Left 981838007 4:149077914-149077936 CCATTTTCCCTTAAAAACAGCAG No data
Right 981838012 4:149077949-149077971 CAAAACAAGGTGTTGAGAGTTGG No data
981838007_981838010 -1 Left 981838007 4:149077914-149077936 CCATTTTCCCTTAAAAACAGCAG No data
Right 981838010 4:149077936-149077958 GTATGTAAATCTCCAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981838007 Original CRISPR CTGCTGTTTTTAAGGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr