ID: 981841159

View in Genome Browser
Species Human (GRCh38)
Location 4:149113940-149113962
Sequence TTGGAGGCAGAGCTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981841156_981841159 -9 Left 981841156 4:149113926-149113948 CCAGTATATCATATTTGGAGGCA No data
Right 981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG No data
981841155_981841159 -8 Left 981841155 4:149113925-149113947 CCCAGTATATCATATTTGGAGGC No data
Right 981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981841159 Original CRISPR TTGGAGGCAGAGCTGGAGGA TGG Intergenic
No off target data available for this crispr