ID: 981841384

View in Genome Browser
Species Human (GRCh38)
Location 4:149116669-149116691
Sequence ATTCAGCCACAAGAATGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981841384_981841388 16 Left 981841384 4:149116669-149116691 CCCAGTCATTCTTGTGGCTGAAT No data
Right 981841388 4:149116708-149116730 ACAACCATATTGTGTTTGATGGG No data
981841384_981841390 23 Left 981841384 4:149116669-149116691 CCCAGTCATTCTTGTGGCTGAAT No data
Right 981841390 4:149116715-149116737 TATTGTGTTTGATGGGTAACAGG No data
981841384_981841387 15 Left 981841384 4:149116669-149116691 CCCAGTCATTCTTGTGGCTGAAT No data
Right 981841387 4:149116707-149116729 TACAACCATATTGTGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981841384 Original CRISPR ATTCAGCCACAAGAATGACT GGG (reversed) Intergenic