ID: 981841387 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:149116707-149116729 |
| Sequence | TACAACCATATTGTGTTTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981841385_981841387 | 14 | Left | 981841385 | 4:149116670-149116692 | CCAGTCATTCTTGTGGCTGAATG | No data | ||
| Right | 981841387 | 4:149116707-149116729 | TACAACCATATTGTGTTTGATGG | No data | ||||
| 981841386_981841387 | -10 | Left | 981841386 | 4:149116694-149116716 | CCTTTGTTTCTACTACAACCATA | No data | ||
| Right | 981841387 | 4:149116707-149116729 | TACAACCATATTGTGTTTGATGG | No data | ||||
| 981841384_981841387 | 15 | Left | 981841384 | 4:149116669-149116691 | CCCAGTCATTCTTGTGGCTGAAT | No data | ||
| Right | 981841387 | 4:149116707-149116729 | TACAACCATATTGTGTTTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981841387 | Original CRISPR | TACAACCATATTGTGTTTGA TGG | Intergenic | ||