ID: 981841388

View in Genome Browser
Species Human (GRCh38)
Location 4:149116708-149116730
Sequence ACAACCATATTGTGTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981841384_981841388 16 Left 981841384 4:149116669-149116691 CCCAGTCATTCTTGTGGCTGAAT No data
Right 981841388 4:149116708-149116730 ACAACCATATTGTGTTTGATGGG No data
981841386_981841388 -9 Left 981841386 4:149116694-149116716 CCTTTGTTTCTACTACAACCATA No data
Right 981841388 4:149116708-149116730 ACAACCATATTGTGTTTGATGGG No data
981841385_981841388 15 Left 981841385 4:149116670-149116692 CCAGTCATTCTTGTGGCTGAATG No data
Right 981841388 4:149116708-149116730 ACAACCATATTGTGTTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981841388 Original CRISPR ACAACCATATTGTGTTTGAT GGG Intergenic