ID: 981842095

View in Genome Browser
Species Human (GRCh38)
Location 4:149124447-149124469
Sequence ATTCCTGCAGCCTGGACACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842095_981842102 0 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842102 4:149124470-149124492 ATTATAGGGTTAGGTTTGGTGGG No data
981842095_981842101 -1 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842101 4:149124469-149124491 TATTATAGGGTTAGGTTTGGTGG No data
981842095_981842099 -9 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842099 4:149124461-149124483 TGCAGGAATATTATAGGGTTAGG No data
981842095_981842107 10 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842107 4:149124480-149124502 TAGGTTTGGTGGGAAGGGGTGGG No data
981842095_981842100 -4 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842100 4:149124466-149124488 GAATATTATAGGGTTAGGTTTGG No data
981842095_981842103 4 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842103 4:149124474-149124496 TAGGGTTAGGTTTGGTGGGAAGG No data
981842095_981842106 9 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842106 4:149124479-149124501 TTAGGTTTGGTGGGAAGGGGTGG No data
981842095_981842104 5 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842104 4:149124475-149124497 AGGGTTAGGTTTGGTGGGAAGGG No data
981842095_981842105 6 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842105 4:149124476-149124498 GGGTTAGGTTTGGTGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842095 Original CRISPR ATTCCTGCAGCCTGGACACT CGG (reversed) Intergenic