ID: 981842096

View in Genome Browser
Species Human (GRCh38)
Location 4:149124455-149124477
Sequence CCTATAATATTCCTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842096_981842105 -2 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842105 4:149124476-149124498 GGGTTAGGTTTGGTGGGAAGGGG No data
981842096_981842107 2 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842107 4:149124480-149124502 TAGGTTTGGTGGGAAGGGGTGGG No data
981842096_981842106 1 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842106 4:149124479-149124501 TTAGGTTTGGTGGGAAGGGGTGG No data
981842096_981842104 -3 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842104 4:149124475-149124497 AGGGTTAGGTTTGGTGGGAAGGG No data
981842096_981842103 -4 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842103 4:149124474-149124496 TAGGGTTAGGTTTGGTGGGAAGG No data
981842096_981842101 -9 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842101 4:149124469-149124491 TATTATAGGGTTAGGTTTGGTGG No data
981842096_981842102 -8 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842102 4:149124470-149124492 ATTATAGGGTTAGGTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842096 Original CRISPR CCTATAATATTCCTGCAGCC TGG (reversed) Intergenic