ID: 981842101

View in Genome Browser
Species Human (GRCh38)
Location 4:149124469-149124491
Sequence TATTATAGGGTTAGGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842096_981842101 -9 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842101 4:149124469-149124491 TATTATAGGGTTAGGTTTGGTGG No data
981842092_981842101 26 Left 981842092 4:149124420-149124442 CCAACTCTAGAGACGAGTAAGCA No data
Right 981842101 4:149124469-149124491 TATTATAGGGTTAGGTTTGGTGG No data
981842095_981842101 -1 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842101 4:149124469-149124491 TATTATAGGGTTAGGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842101 Original CRISPR TATTATAGGGTTAGGTTTGG TGG Intergenic