ID: 981842102

View in Genome Browser
Species Human (GRCh38)
Location 4:149124470-149124492
Sequence ATTATAGGGTTAGGTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842096_981842102 -8 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842102 4:149124470-149124492 ATTATAGGGTTAGGTTTGGTGGG No data
981842092_981842102 27 Left 981842092 4:149124420-149124442 CCAACTCTAGAGACGAGTAAGCA No data
Right 981842102 4:149124470-149124492 ATTATAGGGTTAGGTTTGGTGGG No data
981842095_981842102 0 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842102 4:149124470-149124492 ATTATAGGGTTAGGTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842102 Original CRISPR ATTATAGGGTTAGGTTTGGT GGG Intergenic