ID: 981842106

View in Genome Browser
Species Human (GRCh38)
Location 4:149124479-149124501
Sequence TTAGGTTTGGTGGGAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842095_981842106 9 Left 981842095 4:149124447-149124469 CCGAGTGTCCAGGCTGCAGGAAT No data
Right 981842106 4:149124479-149124501 TTAGGTTTGGTGGGAAGGGGTGG No data
981842096_981842106 1 Left 981842096 4:149124455-149124477 CCAGGCTGCAGGAATATTATAGG No data
Right 981842106 4:149124479-149124501 TTAGGTTTGGTGGGAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842106 Original CRISPR TTAGGTTTGGTGGGAAGGGG TGG Intergenic