ID: 981842885

View in Genome Browser
Species Human (GRCh38)
Location 4:149132891-149132913
Sequence CAACCATTTAATCAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842885_981842886 3 Left 981842885 4:149132891-149132913 CCTAGAGACTGATTAAATGGTTG No data
Right 981842886 4:149132917-149132939 CTAAAATGCTGATAGTGATATGG 0: 50
1: 1103
2: 1749
3: 1520
4: 1057
981842885_981842887 4 Left 981842885 4:149132891-149132913 CCTAGAGACTGATTAAATGGTTG No data
Right 981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG No data
981842885_981842888 18 Left 981842885 4:149132891-149132913 CCTAGAGACTGATTAAATGGTTG No data
Right 981842888 4:149132932-149132954 TGATATGGGCAGTGAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842885 Original CRISPR CAACCATTTAATCAGTCTCT AGG (reversed) Intergenic
No off target data available for this crispr