ID: 981842887

View in Genome Browser
Species Human (GRCh38)
Location 4:149132918-149132940
Sequence TAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981842885_981842887 4 Left 981842885 4:149132891-149132913 CCTAGAGACTGATTAAATGGTTG No data
Right 981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981842887 Original CRISPR TAAAATGCTGATAGTGATAT GGG Intergenic
No off target data available for this crispr