ID: 981856136

View in Genome Browser
Species Human (GRCh38)
Location 4:149295195-149295217
Sequence CATTCTGAAGTATTGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981856136_981856139 23 Left 981856136 4:149295195-149295217 CCAACCTCCAATACTTCAGAATG No data
Right 981856139 4:149295241-149295263 TTTAAGATGTGATTAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981856136 Original CRISPR CATTCTGAAGTATTGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr