ID: 981856883

View in Genome Browser
Species Human (GRCh38)
Location 4:149305487-149305509
Sequence TCACTTCCACTTTTAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981856883_981856887 6 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856887 4:149305516-149305538 TTGACGATAAAGGGAGAAGCGGG No data
981856883_981856884 -4 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856884 4:149305506-149305528 GTGACAAGAATTGACGATAAAGG No data
981856883_981856885 -3 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856885 4:149305507-149305529 TGACAAGAATTGACGATAAAGGG No data
981856883_981856890 22 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856890 4:149305532-149305554 AAGCGGGGGCCAGATCATAAAGG No data
981856883_981856886 5 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856886 4:149305515-149305537 ATTGACGATAAAGGGAGAAGCGG No data
981856883_981856888 7 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856888 4:149305517-149305539 TGACGATAAAGGGAGAAGCGGGG No data
981856883_981856889 8 Left 981856883 4:149305487-149305509 CCAGTCTCTAAAAGTGGAAGTGA No data
Right 981856889 4:149305518-149305540 GACGATAAAGGGAGAAGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981856883 Original CRISPR TCACTTCCACTTTTAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr