ID: 981869321

View in Genome Browser
Species Human (GRCh38)
Location 4:149467807-149467829
Sequence AGGCAGAAGAATAATGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981869321_981869323 6 Left 981869321 4:149467807-149467829 CCAACTTCATTATTCTTCTGCCT No data
Right 981869323 4:149467836-149467858 CTAGTGTTGCTGCCTCCCATTGG No data
981869321_981869325 20 Left 981869321 4:149467807-149467829 CCAACTTCATTATTCTTCTGCCT No data
Right 981869325 4:149467850-149467872 TCCCATTGGCTATACTTAACTGG No data
981869321_981869328 30 Left 981869321 4:149467807-149467829 CCAACTTCATTATTCTTCTGCCT No data
Right 981869328 4:149467860-149467882 TATACTTAACTGGAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981869321 Original CRISPR AGGCAGAAGAATAATGAAGT TGG (reversed) Intergenic
No off target data available for this crispr