ID: 981872091

View in Genome Browser
Species Human (GRCh38)
Location 4:149498537-149498559
Sequence CTGAGCAATACCAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981872082_981872091 20 Left 981872082 4:149498494-149498516 CCTTCTGAGCAAGGGGATCCCAG No data
Right 981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG No data
981872088_981872091 -7 Left 981872088 4:149498521-149498543 CCTGGTACAGCAGGCTCTGAGCA No data
Right 981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG No data
981872084_981872091 2 Left 981872084 4:149498512-149498534 CCCAGCAACCCTGGTACAGCAGG No data
Right 981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG No data
981872087_981872091 -6 Left 981872087 4:149498520-149498542 CCCTGGTACAGCAGGCTCTGAGC No data
Right 981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG No data
981872086_981872091 1 Left 981872086 4:149498513-149498535 CCAGCAACCCTGGTACAGCAGGC No data
Right 981872091 4:149498537-149498559 CTGAGCAATACCAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981872091 Original CRISPR CTGAGCAATACCAAGGAGCA GGG Intergenic
No off target data available for this crispr